Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 126014745 126039693 enh2087

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 126030029 rs183950885 T C,G 2344473
chr11 126030059 rs114837979 G A 2344474
chr11 126030115 rs188946165 C T 2344475
chr11 126030128 rs553670346 GGGCAGGGGTCTCTTTCAGGCCTGTTGAT G 2344476
chr11 126030206 rs77996260 A C 2344477
chr11 126030230 rs372492480 G A 2344478
chr11 126030236 rs115766673 C T 2344479
chr11 126030239 rs11220384 T C 2344480

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results