Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 128692262 128704397 enh60336

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 128693566 rs55647730 A G 2360441
chr11 128693663 rs538088423 G C 2360442
chr11 128693944 rs138634983 T C 2360443
chr11 128694040 rs3016770 T G 2360444
chr11 128694080 rs77159346 C G 2360445
chr11 128694109 rs376752713 TCCTCGGCCCTCTCTGGCCC T 2360446
chr11 128694153 rs11221473 T G 2360447
chr11 128694277 rs561923196 G T 2360448
chr11 128694399 rs148909687 A G 2360449

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results