EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:128693978-128694273]
Chromosome characteristics of ZNF274[chr11:128693978-128694273]
Back to top
Enhancers possibly regulated by ZNF274[chr11:128693978-128694273]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 128692262 128704397 enh60336
Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Stomach Peripheral Blood (MM.1S) Pancreas Pancreas (Panc1) Blood (T-cell) Heart
SNP sites on ZNF274[chr11:128693978-128694273]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 128694040 rs3016770 T G 2360444
chr11 128694080 rs77159346 C G 2360445
chr11 128694109 rs376752713 TCCTCGGCCCTCTCTGGCCC T 2360446
chr11 128694153 rs11221473 T G 2360447
Genes possibly regulated by ZNF274[chr11:128693978-128694273]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:128693978-128694273]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results