Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 68770745 68777495 enh80241

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 68771025 rs371063891 CCCGGGCCCCCACTCCGTTTCTGTATTGCCCT C 2710550
chr12 68771055 rs544017049 CT C 2710551
chr12 68771263 rs560976769 G A 2710552
chr12 68771320 rs79927274 T C 2710553
chr12 68771452 rs11177196 A G 2710554
chr12 68771494 rs74369702 A G 2710555
chr12 68771530 rs138565985 G A 2710556
chr12 68771591 rs148875334 C T 2710557
chr12 68771610 rs79302810 G A,T 2710558
chr12 68771626 rs556664914 G A 2710559
chr12 68771640 rs553221068 G T 2710560
chr12 68771653 rs143310079 T C 2710561
chr12 68771684 rs138856770 A G 2710562

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results