EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr12:93481128-93481533]
Chromosome characteristics of ZNF274[chr12:93481128-93481533]
Back to top
Enhancers possibly regulated by ZNF274[chr12:93481128-93481533]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 93471972 93499275 enh14895
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Astrocyte Bone (Osteoblast) Blood (GM12878) Muscle (A673) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Embryonic Stem Cell Line (H1-hESC) Lung (PC-9) Pancreas (Panc1) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF274[chr12:93481128-93481533]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 93481197 rs139841225 T G 2808657
chr12 93481207 rs370994129 G GTTGATGAGTAAACTATGGC 2808658
chr12 93481207 rs56102560 G GTTGATGAGTAAACTATGGC 2808659
chr12 93481265 rs149558815 T C 2808660
chr12 93481379 rs148743051 T C 2808661
chr12 93481530 rs60843444 G A 2808662
Genes possibly regulated by ZNF274[chr12:93481128-93481533]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr12:93481128-93481533]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results