EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr12:94135669-94136249]
Chromosome characteristics of ZNF143[chr12:94135669-94136249]
Back to top
Enhancers possibly regulated by ZNF143[chr12:94135669-94136249]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 94129705 94139015 enh86138
Bone (Osteoblast) Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas (Panc1) Uterus
chr12 94135673 94136306 vista14463
VISTA
SNP sites on ZNF143[chr12:94135669-94136249]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 94135685 rs115979091 T A 2814482
chr12 94135686 rs141805009 C T 2814483
chr12 94135728 rs78869808 T C 2814484
chr12 94135752 rs55943016 G T 2814485
chr12 94135930 rs191104635 C T 2814486
chr12 94135938 rs183289945 G A 2814487
chr12 94136009 rs7953280 G C 2814488
chr12 94136216 rs576081916 G GCCGGCTGCCTCTGCGGGCC 2814489
chr12 94136234 rs559956905 C G 2814490
Genes possibly regulated by ZNF143[chr12:94135669-94136249]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr12:94135669-94136249]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results