EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr12:94136140-94136630]
Chromosome characteristics of ZNF143[chr12:94136140-94136630]
Back to top
Enhancers possibly regulated by ZNF143[chr12:94136140-94136630]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 94129705 94139015 enh86138
Bone (Osteoblast) Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas (Panc1) Uterus
chr12 94135673 94136306 vista14463
VISTA
SNP sites on ZNF143[chr12:94136140-94136630]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 94136216 rs576081916 G GCCGGCTGCCTCTGCGGGCC 2814489
chr12 94136234 rs559956905 C G 2814490
chr12 94136349 rs112083797 T C 2814491
chr12 94136406 rs4761523 A G 2814492
chr12 94136522 rs186908972 C G,T 2814493
chr12 94136536 rs113487082 C T 2814494
chr12 94136554 rs570636349 A G 2814495
Genes possibly regulated by ZNF143[chr12:94136140-94136630]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr12:94136140-94136630]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results