EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr13:110357037-110357377]
Chromosome characteristics of ZZZ3[chr13:110357037-110357377]
Back to top
Enhancers possibly regulated by ZZZ3[chr13:110357037-110357377]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 110355205 110361635 enh47716
Prostate (PC-3) Cervix (HeLa-S3) Stomach Muscle (A673) Heart Thymus Epithelial (MCF-7)
SNP sites on ZZZ3[chr13:110357037-110357377]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 110357062 rs540052943 A C 3387008
chr13 110357080 rs74123709 A C 3387009
chr13 110357141 rs58500822 T C 3387010
chr13 110357256 rs367828293 CTGGCAGGTCACCCTCCTCCCTGTA C 3387011
chr13 110357273 rs563974388 T TC 3387012
chr13 110357324 rs146440925 G A,C 3387013
Genes possibly regulated by ZZZ3[chr13:110357037-110357377]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr13:110357037-110357377]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results