Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 110355205 110361635 enh47716

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 110357256 rs367828293 CTGGCAGGTCACCCTCCTCCCTGTA C 3387011
chr13 110357273 rs563974388 T TC 3387012
chr13 110357324 rs146440925 G A,C 3387013
chr13 110357390 rs117529247 C T 3387014
chr13 110357391 rs139919379 G A 3387015
chr13 110357405 rs117883562 A G 3387016
chr13 110357407 rs58781450 G A 3387017
chr13 110357447 rs33991559 GAA G 3387018
chr13 110357447 rs398056870 GAA G 3387019
chr13 110357447 rs528870554 GA G 3387020
chr13 110357447 rs869130882 GAA G 3387021
chr13 110357515 rs876706 G A 3387022

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results