EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr13:111240980-111241370]
Chromosome characteristics of ZNF143[chr13:111240980-111241370]
Back to top
Enhancers possibly regulated by ZNF143[chr13:111240980-111241370]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 111240285 111247115 enh3017
Epithelial (MCF-7) Placenta Blood (Karpas-422) Lung (PC-9) Stomach
SNP sites on ZNF143[chr13:111240980-111241370]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 111241021 rs201163958 GTTT G 3396380
chr13 111241026 rs77804996 T C 3396381
chr13 111241068 rs528109514 C CAAAGGAATGAGAGAACTAATACAATTTGGAAAAAG 3396382
chr13 111241250 rs192511336 C T 3396383
chr13 111241314 rs555071796 T C 3396384
chr13 111241335 rs79035791 G A,C 3396385
Genes possibly regulated by ZNF143[chr13:111240980-111241370]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr13:111240980-111241370]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results