Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 113925325 113932010 enh3023

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 113929773 rs554534056 C A 3409234
chr13 113929888 rs75927021 C T 3409235
chr13 113929894 rs147116042 C A 3409236
chr13 113929918 rs566630406 AGCCCTTCAGGTTAGCCTTGGAAAT A 3409237
chr13 113929985 rs541776963 C T 3409238
chr13 113929994 rs202008013 TTA T 3409239
chr13 113930001 rs73581062 T C 3409240

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results