EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:103785644-103786054]
Chromosome characteristics of ZZZ3[chr14:103785644-103786054]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:103785644-103786054]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103778065 103788238 enh15978
Bone Marrow (K562) Prostate (RWPE1) Blood (GM12878) Stomach Placenta Pancreas Heart
chr14 103785779 103785970 vista19204
VISTA
SNP sites on ZZZ3[chr14:103785644-103786054]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103785698 rs549301389 G C 3813245
chr14 103785700 rs377021422 G GTACCTGACCCCAAAAAGCCCTTCCAGGC 3813246
chr14 103785700 rs551141992 G GTACCTGACCCCAAAAAGCCCTTCCAGGC 3813247
chr14 103785700 rs565872565 G C 3813248
chr14 103785838 rs534862716 C G 3813249
chr14 103785922 rs116105670 C G,T 3813250
Genes possibly regulated by ZZZ3[chr14:103785644-103786054]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:103785644-103786054]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results