EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr14:104688742-104690020]
Chromosome characteristics of TCF7L2[chr14:104688742-104690020]
Back to top
Enhancers possibly regulated by TCF7L2[chr14:104688742-104690020]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104683866 104698135 enh47819
Prostate (PC-3) Brain (SK-N-SH) Brain (SK-N-MC) Large Intestine Stomach Muscle (A673) Colon (HCT116) Pancreas Thymus Epithelial (MCF-7)
SNP sites on TCF7L2[chr14:104688742-104690020]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104688847 rs554147717 G A 3819943
chr14 104688890 rs536736538 G A 3819944
chr14 104689000 rs142595440 GTCAT G 3819945
chr14 104689127 rs535766474 A G 3819946
chr14 104689156 rs143074564 G A 3819947
chr14 104689391 rs549315893 C A,T 3819948
chr14 104689524 rs576262492 G A 3819949
chr14 104689545 rs72717024 C G 3819950
chr14 104689597 rs74087235 C A,T 3819951
chr14 104689699 rs73362241 C T 3819952
chr14 104689705 rs369898118 C A 3819953
chr14 104689730 rs527246427 CCTGCCGCCCCCGCCCCCACCCCAG C 3819954
chr14 104689741 rs534999082 C T 3819955
chr14 104689764 rs558167841 C G 3819956
chr14 104689805 rs145179438 C T 3819957
chr14 104689808 rs541957193 CA C 3819958
chr14 104689911 rs200843229 G A 3819959
Genes possibly regulated by TCF7L2[chr14:104688742-104690020]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr14:104688742-104690020]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results