Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104683866 104698135 enh47819

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104689545 rs72717024 C G 3819950
chr14 104689597 rs74087235 C A,T 3819951
chr14 104689699 rs73362241 C T 3819952
chr14 104689705 rs369898118 C A 3819953
chr14 104689730 rs527246427 CCTGCCGCCCCCGCCCCCACCCCAG C 3819954
chr14 104689741 rs534999082 C T 3819955
chr14 104689764 rs558167841 C G 3819956
chr14 104689805 rs145179438 C T 3819957
chr14 104689808 rs541957193 CA C 3819958
chr14 104689911 rs200843229 G A 3819959
chr14 104690122 rs566976289 G A,T 3819960
chr14 104690154 rs529737775 G T 3819961
chr14 104690155 rs77505595 T G 3819962
chr14 104690313 rs79043514 CT C 3819963
chr14 104690408 rs530858453 ATACTT A 3819964

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results