EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:105122879-105123119]
Chromosome characteristics of ZZZ3[chr14:105122879-105123119]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:105122879-105123119]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105120721 105134695 enh3485
Cervix (HeLa-S3) Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Blood (Karpas-422) Pancreas Thymus Epithelial (MCF-7)
SNP sites on ZZZ3[chr14:105122879-105123119]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105122992 rs78785617 G A 3824190
chr14 105122998 rs549474803 G A 3824191
chr14 105123030 rs566067374 G A,C 3824192
chr14 105123038 rs139081834 CGGAGAGGAGGCCTCTCCTCGG C 3824193
chr14 105123038 rs376247301 CGGAGAGGAGGCCTCTCCTCGG C 3824194
chr14 105123038 rs534999680 C G,T 3824195
chr14 105123051 rs558223383 T C 3824196
chr14 105123058 rs577995231 G A,T 3824197
chr14 105123070 rs537346372 G T 3824198
Genes possibly regulated by ZZZ3[chr14:105122879-105123119]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:105122879-105123119]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results