Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 105120721 105134695 enh3485

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 105126291 rs562433527 C G,T 3824238
chr14 105126319 rs10873549 T C 3824239
chr14 105126352 rs148336006 C T 3824240
chr14 105126354 rs4074077 A C 3824241
chr14 105126507 rs60868279 A G 3824242
chr14 105126595 rs369611054 T C 3824243
chr14 105126701 rs140669483 CCTCCGTCTGGAGCCCCTCCCGATGGCCGTCG C 3824244
chr14 105126701 rs58384467 CCTCCGTCTGGAGCCCCTCCCGATGGCCGTCG C 3824245

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results