Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 57602525 57607555 enh52020

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 57605274 rs10518910 T G 3977331
chr15 57605328 rs111379720 G A 3977332
chr15 57605358 rs10152582 G A 3977333
chr15 57605392 rs571335691 A AACACCTGGGAAGATCAGAGCTAATTCTTGGGGTCC 3977334
chr15 57605462 rs140916343 G A 3977335
chr15 57605464 rs181491574 G C 3977336

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results