Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 68774965 68782535 enh44137

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 68775646 rs143661562 G T 4051844
chr15 68775691 rs7169547 A G 4051845
chr15 68775791 rs7171188 T A 4051846
chr15 68775908 rs534461327 CTCAGAAGCCCCAGTCCATCACT C 4051847
chr15 68776091 rs138146650 A C 4051848
chr15 68776153 rs189129091 A G 4051849
chr15 68776296 rs60696164 C T 4051850
chr15 68776484 rs141728543 C G,T 4051851
chr15 68776525 rs111760888 A T 4051852
chr15 68776536 rs183771440 G A 4051853
chr15 68776539 rs150600568 G C 4051854

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results