Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99554485 99565188 enh44220

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99558052 rs530110944 G A 4223027
chr15 99558092 rs541231201 G T 4223028
chr15 99558140 rs574637210 C T 4223029
chr15 99558179 rs113537548 C G 4223030
chr15 99558233 rs148636556 G A 4223031
chr15 99558253 rs58618949 T A 4223032
chr15 99558290 rs61408310 A G 4223033
chr15 99558293 rs551282847 G A,T 4223034
chr15 99558305 rs113481070 C A 4223035
chr15 99558313 rs558237680 G A 4223036
chr15 99558369 rs59467480 A C 4223037
chr15 99558384 rs28682903 A G 4223038
chr15 99558398 rs541744312 C G 4223039
chr15 99558420 rs79572834 A T 4223040
chr15 99558433 rs201217092 CCCCGGCCTCGGCG C 4223041
chr15 99558433 rs571601740 C CCCCGGCCTCGGCG 4223042
chr15 99558634 rs73468258 C G 4223043
chr15 99558694 rs199834486 GCGCAGAGGTGGAGCGGGTCGGGGT G 4223044
chr15 99558703 rs529523822 T C 4223045
chr15 99558718 rs550958948 T G 4223046

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results