Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 102103105 102122329 enh31659

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 102104968 rs572221930 A G 4242521
chr15 102105086 rs540056629 TGACCACAGCCCAGAAGGACAGG T 4242522
chr15 102105098 rs138286291 A G 4242523

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results