EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr16:10716042-10716506]
Chromosome characteristics of ZZZ3[chr16:10716042-10716506]
Back to top
Enhancers possibly regulated by ZZZ3[chr16:10716042-10716506]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 10701175 10720664 enh16528
Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Prostate (RWPE1) Ovary Esophagus Astrocyte Brain (SK-N-SH) Bone (Osteoblast) Lung (A549) Stomach Muscle (A673) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Heart
SNP sites on ZZZ3[chr16:10716042-10716506]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 10716063 rs145690343 CAGCTGATGGGTCTCCCTTATCTTCCG C 4309358
chr16 10716063 rs376434355 CAGCTGATGGGTCTCCCTTATCTTCCG C 4309359
chr16 10716089 rs11645017 G A 4309360
chr16 10716140 rs527621555 C CCAG 4309361
chr16 10716194 rs550494581 G A 4309362
chr16 10716221 rs74481375 C T 4309363
chr16 10716357 rs76519669 T C 4309364
Genes possibly regulated by ZZZ3[chr16:10716042-10716506]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr16:10716042-10716506]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results