EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:11077324-11079853]
Chromosome characteristics of ZNF274[chr16:11077324-11079853]
Back to top
Enhancers possibly regulated by ZNF274[chr16:11077324-11079853]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 11079525 11094375 enh3881
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Lung (PC-9) Esophagus Astrocyte Bone (Osteoblast) Lung (A549) Blood (GM12878) Muscle (A673) Placenta Blood (Karpas-422) Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Thymus Epithelial (MCF-7)
chr16 11078476 11078702 vista21830
VISTA
SNP sites on ZNF274[chr16:11077324-11079853]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 11077357 rs180861393 C T 4313174
chr16 11077469 rs111502478 A G 4313175
chr16 11077511 rs552885147 C G 4313176
chr16 11077574 rs4781029 T C 4313177
chr16 11077583 rs377226434 C G 4313178
chr16 11077920 rs77504659 C T 4313179
chr16 11077974 rs574490311 G A 4313180
chr16 11077977 rs76518417 C A 4313181
chr16 11077994 rs112469895 C T 4313182
chr16 11078039 rs185737227 A G 4313183
chr16 11078081 rs78121798 C T 4313184
chr16 11078175 rs115890664 C A 4313185
chr16 11078338 rs7201845 G A 4313186
chr16 11078344 rs79032217 G A 4313187
chr16 11078397 rs536251345 ACT A 4313188
chr16 11078497 rs17803907 G A 4313189
chr16 11078558 rs12325659 C G 4313190
chr16 11078615 rs7202408 G A 4313191
chr16 11078786 rs113532301 C T 4313192
chr16 11078927 rs527650928 G A 4313193
chr16 11078977 rs564193912 G T 4313194
chr16 11079022 rs11646935 T A 4313195
chr16 11079161 rs9652599 A C,G 4313196
chr16 11079214 rs377539997 CAGATTTTTGGAATCTTCTCCAACAGTCAGAAGATCT C 4313197
chr16 11079226 rs184156305 A C 4313198
chr16 11079250 rs567982147 T C 4313199
chr16 11079276 rs528225195 G A 4313200
chr16 11079404 rs61260965 CT C 4313201
chr16 11079404 rs796945107 CT C 4313202
chr16 11079418 rs542180297 T C 4313203
chr16 11079452 rs72770083 C G,T 4313204
chr16 11079615 rs543487269 C G 4313205
chr16 11079723 rs148130007 C T 4313206
chr16 11079744 rs141685587 G A 4313207
chr16 11079754 rs183821428 G T 4313208
chr16 11079777 rs539569921 G C,T 4313209
Genes possibly regulated by ZNF274[chr16:11077324-11079853]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:11077324-11079853]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results