Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 23263865 23273675 enh16602

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 23269167 rs74012852 G T 4374434
chr16 23269274 rs571512129 G A 4374435
chr16 23269322 rs143003451 A T 4374436
chr16 23269349 rs62031946 T C 4374437
chr16 23269393 rs146126720 T C 4374438
chr16 23269438 rs115148518 G A 4374439
chr16 23269493 rs575413529 T C 4374440
chr16 23269620 rs557937040 C T 4374441
chr16 23269666 rs540190231 A AGTTAGTCTTGTTCAGGACGCAAG 4374442
chr16 23269916 rs73540375 C T 4374443
chr16 23269956 rs9302403 C T 4374444
chr16 23269970 rs17794722 C A 4374445
chr16 23270083 rs140158510 T C 4374446
chr16 23270149 rs538134849 C A,G,T 4374447

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results