Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 29730993 29745943 enh16625

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 29740458 rs373967454 A AAAGTGCGGGCATTACAGGT,AAAGTGCTGGGATTACAGGC,AGGT 4405690
chr16 29740557 rs62054880 A G 4405691
chr16 29740571 rs62054881 G A 4405692
chr16 29740645 rs648559 G C 4405693
chr16 29740659 rs189441758 C T 4405694
chr16 29740725 rs551700209 A G 4405695
chr16 29740993 rs150651507 T A 4405696
chr16 29741048 rs565891476 C G 4405697

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results