EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:81455633-81458883]
Chromosome characteristics of TCF7L2[chr16:81455633-81458883]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:81455633-81458883]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 81453285 81472414 enh31955
Prostate (PC-3) Lung (PC-9) Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Colon (HCT116) Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Thymus Stomach
SNP sites on TCF7L2[chr16:81455633-81458883]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 81455645 rs115142297 C T 4582244
chr16 81455646 rs12599356 G A 4582245
chr16 81455655 rs2615713 C T 4582246
chr16 81455658 rs2608565 G A 4582247
chr16 81455704 rs143890925 G C 4582248
chr16 81455760 rs200078234 C CA 4582249
chr16 81455819 rs11865413 G A 4582250
chr16 81455885 rs184004680 C G 4582251
chr16 81455923 rs2615712 G C 4582252
chr16 81455928 rs2615711 G A 4582253
chr16 81456053 rs188448223 C T 4582254
chr16 81456070 rs143945590 G A 4582255
chr16 81456112 rs146835023 A G 4582256
chr16 81456148 rs570122903 G A 4582257
chr16 81456172 rs9927898 A G 4582258
chr16 81456173 rs559118458 T C 4582259
chr16 81456353 rs575336884 G T 4582260
chr16 81456416 rs144256046 A G 4582261
chr16 81456444 rs377187251 A AAT,ATATATATATATATACCACATATATATACCG 4582262
chr16 81456464 rs9932388 T A,C 4582263
chr16 81456471 rs563852429 C T 4582264
chr16 81456472 rs141004717 G A 4582265
chr16 81456472 rs539178895 G GTA 4582266
chr16 81456501 rs185026668 A G 4582267
chr16 81456525 rs62043898 G A 4582268
chr16 81456526 rs62043899 T C 4582269
chr16 81456546 rs11648860 G A 4582270
chr16 81456640 rs112884883 A C 4582271
chr16 81456673 rs115213072 G A,C 4582272
chr16 81456710 rs6564881 C A 4582273
chr16 81456836 rs574785967 G A 4582274
chr16 81456923 rs2911435 C T 4582275
chr16 81456998 rs568242903 C T 4582276
chr16 81457016 rs572646538 G A 4582277
chr16 81457062 rs138802349 G A 4582278
chr16 81457234 rs146162369 AAAAT A 4582279
chr16 81457433 rs570949181 A T 4582280
chr16 81457493 rs8063926 G A 4582281
chr16 81457583 rs557354225 C G,T 4582282
chr16 81457659 rs8044853 C T 4582283
chr16 81457725 rs148002307 C A,T 4582284
chr16 81457736 rs8043771 G A 4582285
chr16 81457769 rs141707339 C T 4582286
chr16 81457792 rs7191231 T A 4582287
chr16 81457827 rs191903606 C T 4582288
chr16 81457838 rs7186540 A G 4582289
chr16 81457873 rs117739306 G A 4582290
chr16 81457942 rs187252448 G T 4582291
chr16 81457963 rs7186064 C A,T 4582292
chr16 81458011 rs534159050 T C 4582293
chr16 81458027 rs573729380 C T 4582294
chr16 81458032 rs7191804 T C 4582295
chr16 81458097 rs77544455 C T 4582296
chr16 81458119 rs182417042 A G 4582297
chr16 81458125 rs542836103 G T 4582298
chr16 81458193 rs117622671 C T 4582299
chr16 81458252 rs370410124 C T 4582300
chr16 81458315 rs143855170 A T 4582301
chr16 81458343 rs549597171 A C 4582302
chr16 81458429 rs9941113 A G 4582303
chr16 81458464 rs555460288 GA G 4582304
chr16 81458486 rs115976682 A C 4582305
chr16 81458511 rs139777874 G C 4582306
chr16 81458523 rs188592065 A G 4582307
chr16 81458569 rs150029731 G A 4582308
chr16 81458592 rs560406568 C G 4582309
chr16 81458672 rs76220079 G A 4582310
chr16 81458673 rs75157654 A T 4582311
chr16 81458730 rs571392614 C G 4582312
Genes possibly regulated by TCF7L2[chr16:81455633-81458883]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:81455633-81458883]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results