EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:83861286-83861543]
Chromosome characteristics of ZNF143[chr16:83861286-83861543]
Back to top
Enhancers possibly regulated by ZNF143[chr16:83861286-83861543]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 83855815 83862035 enh52379
Neural Stem Cells (H9) Large Intestine Epithelial (MCF-7)
SNP sites on ZNF143[chr16:83861286-83861543]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 83861303 rs153657 G A,C 4602361
chr16 83861318 rs153658 G A 4602362
chr16 83861340 rs6563983 G A 4602363
chr16 83861345 rs539668194 C A,T 4602364
chr16 83861350 rs6563984 A G,T 4602365
chr16 83861354 rs117489707 T C,G 4602366
chr16 83861490 rs534866538 TCCTCAGTTTGGGGTTGTAAGCC T 4602367
Genes possibly regulated by ZNF143[chr16:83861286-83861543]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:83861286-83861543]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results