Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 83855815 83862035 enh52379

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 83861303 rs153657 G A,C 4602361
chr16 83861318 rs153658 G A 4602362
chr16 83861340 rs6563983 G A 4602363
chr16 83861345 rs539668194 C A,T 4602364
chr16 83861350 rs6563984 A G,T 4602365
chr16 83861354 rs117489707 T C,G 4602366
chr16 83861490 rs534866538 TCCTCAGTTTGGGGTTGTAAGCC T 4602367

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results