EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:85392960-85395604]
Chromosome characteristics of ZNF143[chr16:85392960-85395604]
Back to top
Enhancers possibly regulated by ZNF143[chr16:85392960-85395604]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85390172 85421515 enh16868
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-MC) Large Intestine Brain (SK-N-SH) Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Thyroid Lung (PC-9) Pancreas Muscle (Myotube) Heart
chr16 85395325 85395548 vista23296
VISTA
SNP sites on ZNF143[chr16:85392960-85395604]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85392967 rs147019304 C G,T 4621474
chr16 85393188 rs57953410 C A 4621475
chr16 85393230 rs182900289 C G 4621476
chr16 85393284 rs139025425 C T 4621477
chr16 85393301 rs116826510 T C 4621478
chr16 85393348 rs372688238 C T 4621479
chr16 85393361 rs377283304 G A,T 4621480
chr16 85393373 rs558906871 C T 4621481
chr16 85393376 rs142949063 C T 4621482
chr16 85393400 rs561424094 C G 4621483
chr16 85393467 rs544042457 T C 4621484
chr16 85393520 rs144683339 G C 4621485
chr16 85393588 rs114415387 C T 4621486
chr16 85393604 rs548437066 C G 4621487
chr16 85393647 rs568279684 T A 4621488
chr16 85393682 rs77000540 A G,T 4621489
chr16 85393853 rs535972042 TG T 4621490
chr16 85393859 rs544298421 CG C 4621491
chr16 85393860 rs74752009 G A 4621492
chr16 85393873 rs150661012 T A 4621493
chr16 85393879 rs376309089 G A 4621494
chr16 85393882 rs530711814 G A 4621495
chr16 85393972 rs539250895 C T 4621496
chr16 85393978 rs534099095 GGGGGCAGGTGGGGCAGGGCC G 4621497
chr16 85394014 rs535151094 G A,C,T 4621498
chr16 85394085 rs117934442 A T 4621499
chr16 85394185 rs140146446 G A 4621500
chr16 85394193 rs58109097 G A 4621501
chr16 85394260 rs146406568 G A 4621502
chr16 85394289 rs530433549 A T 4621503
chr16 85394306 rs550413379 A C,T 4621504
chr16 85394308 rs79003194 G A 4621505
chr16 85394370 rs187508529 G T 4621506
chr16 85394378 rs900750 G A 4621507
chr16 85394402 rs900749 C T 4621508
chr16 85394439 rs139761593 C G 4621509
chr16 85394524 rs4602029 C A,G 4621510
chr16 85394526 rs900748 A G 4621511
chr16 85394576 rs900747 T C 4621512
chr16 85394614 rs11861543 C T 4621513
chr16 85394744 rs3054200 C CA,CC,CCA 4621514
chr16 85394744 rs397799616 C CCA 4621515
chr16 85394803 rs184988153 C A 4621516
chr16 85394805 rs568585907 A C 4621517
chr16 85394834 rs112993204 A G 4621518
chr16 85394843 rs199927872 CAT C 4621519
chr16 85394876 rs2009842 T C 4621520
chr16 85394882 rs2005021 C T 4621521
chr16 85394883 rs2009841 G A 4621522
chr16 85394934 rs5818530 AAC A 4621523
chr16 85394934 rs72242323 AAC A 4621524
chr16 85394962 rs565731859 GAC G 4621525
chr16 85394971 rs72811734 A G 4621526
chr16 85394984 rs77131713 C A 4621527
chr16 85394989 rs560420293 C A 4621528
chr16 85395005 rs529047342 A G 4621529
chr16 85395156 rs531023996 C A 4621530
chr16 85395157 rs537220164 TGGCACTGGCTGGG T 4621531
chr16 85395176 rs753910 A G 4621532
chr16 85395216 rs16975559 G A 4621533
chr16 85395331 rs147820281 C T 4621534
chr16 85395334 rs116201742 C G 4621535
chr16 85395368 rs557437178 G A 4621536
chr16 85395402 rs74031798 G A 4621537
chr16 85395459 rs184575984 C T 4621538
chr16 85395460 rs75903237 G A 4621539
chr16 85395463 rs188209407 C T 4621540
chr16 85395470 rs564625605 C T 4621541
chr16 85395473 rs74712184 G A,T 4621542
chr16 85395525 rs531040211 A G 4621543
chr16 85395565 rs115371262 C G 4621544
Genes possibly regulated by ZNF143[chr16:85392960-85395604]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:85392960-85395604]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results