Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85393647 rs568279684 T A 4621488
chr16 85393682 rs77000540 A G,T 4621489
chr16 85393853 rs535972042 TG T 4621490
chr16 85393859 rs544298421 CG C 4621491
chr16 85393860 rs74752009 G A 4621492
chr16 85393873 rs150661012 T A 4621493
chr16 85393879 rs376309089 G A 4621494
chr16 85393882 rs530711814 G A 4621495
chr16 85393972 rs539250895 C T 4621496
chr16 85393978 rs534099095 GGGGGCAGGTGGGGCAGGGCC G 4621497
chr16 85394014 rs535151094 G A,C,T 4621498
chr16 85394085 rs117934442 A T 4621499
chr16 85394185 rs140146446 G A 4621500

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results