Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85413702 rs73257360 T C 4621891
chr16 85413727 rs192090452 A G 4621892
chr16 85413783 rs11149738 G A 4621893
chr16 85413976 rs4783179 T C 4621894
chr16 85413999 rs150280492 T C 4621895
chr16 85414109 rs535452014 G T 4621896
chr16 85414157 rs147784228 ACTGCCCGCCGGGGGAGGCCTCT A 4621897
chr16 85414157 rs375714252 ACTGCCCGCCGGGGGAGGCCTCT A 4621898

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results