Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85414157 rs147784228 ACTGCCCGCCGGGGGAGGCCTCT A 4621897
chr16 85414157 rs375714252 ACTGCCCGCCGGGGGAGGCCTCT A 4621898
chr16 85414245 rs76955124 T C 4621899
chr16 85414301 rs143448058 G A 4621900
chr16 85414347 rs137915063 A C,G 4621901
chr16 85414354 rs74694955 C G,T 4621902
chr16 85414355 rs76563408 G A 4621903
chr16 85414472 rs11646032 G A,C 4621904

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results