Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 90058505 90068858 enh16911

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 90061641 rs537172140 ACAGGGATGACTCAG A 4680903
chr16 90061670 rs547911596 C T 4680904
chr16 90061673 rs566109887 C T 4680905
chr16 90061688 rs199869193 A G 4680906
chr16 90061700 rs545243617 AGATGACTTAGTACTGCCCCTCAGCAGG A 4680907
chr16 90061702 rs570348341 A T 4680908
chr16 90061708 rs200955819 T C 4680909
chr16 90061716 rs555933943 C T 4680910

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results