Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 1499092 1514135 enh16927
chr17 1509587 1509868 vista23663

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 1509319 rs76997747 G A 4695245
chr17 1509411 rs9903662 C T 4695246
chr17 1509423 rs529740169 AGACCCTCCAGAGCTGGCCGGGGGCCACCGCGGGACCCTCTCCTG A 4695247
chr17 1509453 rs570579858 C T 4695248
chr17 1509460 rs539299509 C T 4695249
chr17 1509467 rs556485641 G A 4695250
chr17 1509567 rs572360466 G A 4695251
chr17 1509631 rs78331739 C G 4695252
chr17 1509720 rs141500093 C T 4695253

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results