EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:53819952-53820228]
Chromosome characteristics of ZNF274[chr17:53819952-53820228]
Back to top
Enhancers possibly regulated by ZNF274[chr17:53819952-53820228]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 53817765 53822718 enh58768
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Peripheral Blood (MM.1S) Lung (PC-9) Epithelial (MCF-7)
SNP sites on ZNF274[chr17:53819952-53820228]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 53820021 rs373852951 C T 4941658
chr17 53820074 rs2960086 G A 4941659
chr17 53820117 rs150314393 T C 4941660
chr17 53820185 rs553728692 T TGTCTGGTTCTTAAAGTGACTA 4941661
chr17 53820186 rs2912544 G C 4941662
Genes possibly regulated by ZNF274[chr17:53819952-53820228]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:53819952-53820228]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results