EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr17:61540056-61540572]
Chromosome characteristics of ZZZ3[chr17:61540056-61540572]
Back to top
Enhancers possibly regulated by ZZZ3[chr17:61540056-61540572]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 61536180 61542155 enh32274
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Esophagus Astrocyte Lung (PC-9) Uterus Epithelial (MCF-7)
SNP sites on ZZZ3[chr17:61540056-61540572]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 61540089 rs550772557 CAATAAGCCTGGCCTGGGGCGGTGGCTCATGCCTGTAAT C 4978185
chr17 61540109 rs143951418 G A 4978186
chr17 61540113 rs12150648 G A 4978187
chr17 61540223 rs142120257 A C 4978188
chr17 61540230 rs187395322 C T 4978189
chr17 61540274 rs193095538 C G 4978190
chr17 61540278 rs113204649 G A 4978191
chr17 61540311 rs144484876 T A 4978192
chr17 61540325 rs146645879 A C,G 4978193
chr17 61540351 rs149418624 G A 4978194
chr17 61540422 rs150205152 A G,T 4978195
chr17 61540517 rs566453320 G T 4978196
Genes possibly regulated by ZZZ3[chr17:61540056-61540572]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr17:61540056-61540572]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results