Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 63056425 63063130 enh17303

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 63062872 rs537249169 C G 4987747
chr17 63062923 rs184267856 G T 4987748
chr17 63062952 rs114294783 T A 4987749
chr17 63063132 rs149431893 CGCCCATGCTCTGTGCACTCCTTCACCCCCAGCAGCTGCCACTGGACA C 4987750
chr17 63063233 rs114023933 C G 4987751
chr17 63063396 rs567547388 C T 4987752
chr17 63063412 rs1476171 T C 4987753
chr17 63063451 rs11651495 A C 4987754
chr17 63063524 rs116268650 G A 4987755
chr17 63063833 rs75086578 T G 4987756

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results