EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:75857819-75859745]
Chromosome characteristics of ZNF274[chr17:75857819-75859745]
Back to top
Enhancers possibly regulated by ZNF274[chr17:75857819-75859745]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75857325 75875375 enh4619
Bone Marrow (K562) Brain (SK-N-SH) Blood (T-cell) Astrocyte Blood (OCI-LY7) Stomach Muscle (A673) Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Muscle (Myoblast) Muscle (Myotube) Thymus Heart
SNP sites on ZNF274[chr17:75857819-75859745]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75857833 rs117481249 C T 5080536
chr17 75857902 rs139586419 G C 5080537
chr17 75857938 rs149713192 C T 5080538
chr17 75857949 rs117696136 C T 5080539
chr17 75857981 rs62078477 C G 5080540
chr17 75858068 rs79124576 A G 5080541
chr17 75858192 rs74000946 C T 5080542
chr17 75858210 rs529450290 C G 5080543
chr17 75858286 rs61251363 G A 5080544
chr17 75858320 rs185304237 G A 5080545
chr17 75858370 rs554035485 T C 5080546
chr17 75858471 rs556381100 C T 5080547
chr17 75858472 rs79790026 G A 5080548
chr17 75858476 rs187233977 C T 5080549
chr17 75858489 rs74000947 C T 5080550
chr17 75858533 rs7221480 T C,G 5080551
chr17 75858596 rs539449634 G GCA 5080552
chr17 75858596 rs775786842 G GCA 5080553
chr17 75858598 rs560427154 A G 5080554
chr17 75858601 rs111821573 C CAT 5080555
chr17 75858601 rs74276859 C CAT 5080556
chr17 75858603 rs201879066 C T 5080557
chr17 75858706 rs735658 C T 5080558
chr17 75858850 rs148928272 C T 5080559
chr17 75858937 rs62078478 G C 5080560
chr17 75858971 rs11650857 C T 5080561
chr17 75858998 rs569824522 G C 5080562
chr17 75859033 rs74000948 C T 5080563
chr17 75859162 rs373905837 A G 5080564
chr17 75859190 rs71942708 ATATCTTCAGTCTATAGAATGACGATAATG A 5080565
chr17 75859281 rs141060426 A G 5080566
chr17 75859346 rs146713646 A T 5080567
chr17 75859374 rs74000949 G A 5080568
chr17 75859397 rs190414993 C T 5080569
chr17 75859429 rs182719568 G A 5080570
chr17 75859441 rs138742601 G A,T 5080571
chr17 75859525 rs59314777 C T 5080572
chr17 75859580 rs62078479 T C 5080573
chr17 75859634 rs62078480 C T 5080574
chr17 75859709 rs141178882 C T 5080575
Genes possibly regulated by ZNF274[chr17:75857819-75859745]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:75857819-75859745]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results