Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75858533 rs7221480 T C,G 5080551
chr17 75858596 rs539449634 G GCA 5080552
chr17 75858596 rs775786842 G GCA 5080553
chr17 75858598 rs560427154 A G 5080554
chr17 75858601 rs111821573 C CAT 5080555
chr17 75858601 rs74276859 C CAT 5080556
chr17 75858603 rs201879066 C T 5080557
chr17 75858706 rs735658 C T 5080558
chr17 75858850 rs148928272 C T 5080559
chr17 75858937 rs62078478 G C 5080560
chr17 75858971 rs11650857 C T 5080561
chr17 75858998 rs569824522 G C 5080562
chr17 75859033 rs74000948 C T 5080563
chr17 75859162 rs373905837 A G 5080564
chr17 75859190 rs71942708 ATATCTTCAGTCTATAGAATGACGATAATG A 5080565
chr17 75859281 rs141060426 A G 5080566

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results