Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75858937 rs62078478 G C 5080560
chr17 75858971 rs11650857 C T 5080561
chr17 75858998 rs569824522 G C 5080562
chr17 75859033 rs74000948 C T 5080563
chr17 75859162 rs373905837 A G 5080564
chr17 75859190 rs71942708 ATATCTTCAGTCTATAGAATGACGATAATG A 5080565
chr17 75859281 rs141060426 A G 5080566

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results