EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr17:77801973-77803683]
Chromosome characteristics of ZBTB33[chr17:77801973-77803683]
Back to top
Enhancers possibly regulated by ZBTB33[chr17:77801973-77803683]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 77780565 77806815 enh4626
Bone Marrow (K562) Liver (HepG2) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-SH) Stomach Muscle (A673) Placenta Blood (Karpas-422) Pancreas Pancreas (Panc1) Thymus Heart
SNP sites on ZBTB33[chr17:77801973-77803683]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 77801977 rs73422112 C T 5097152
chr17 77802119 rs1025925 G C 5097153
chr17 77802298 rs144509249 GTC G 5097154
chr17 77802298 rs746025882 GTC G 5097155
chr17 77802564 rs144429304 G T 5097156
chr17 77802710 rs539286399 C T 5097157
chr17 77802715 rs557581121 C A 5097158
chr17 77802729 rs13341333 G C 5097159
chr17 77802967 rs9914360 T C 5097160
chr17 77802968 rs9902362 G T 5097161
chr17 77802989 rs563093550 C T 5097162
chr17 77803011 rs72846510 C T 5097163
chr17 77803087 rs561011213 G A 5097164
chr17 77803190 rs72846512 G A 5097165
chr17 77803270 rs9903026 G A 5097166
chr17 77803272 rs575674359 GCTTTAGAGAGGGGGAGAGGGGTCAGGAGAGTT G 5097167
chr17 77803540 rs199529851 C T 5097168
Genes possibly regulated by ZBTB33[chr17:77801973-77803683]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr17:77801973-77803683]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results