EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr17:79455039-79455555]
Chromosome characteristics of ZZZ3[chr17:79455039-79455555]
Back to top
Enhancers possibly regulated by ZZZ3[chr17:79455039-79455555]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79444325 79464275 enh32379
Cervix (HeLa-S3) Brain (SK-N-SH) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Blood (T-cell) Astrocyte Lung (A549) Muscle (A673) Thyroid Pancreas Muscle (Myotube) Uterus Thymus Epithelial (MCF-7)
SNP sites on ZZZ3[chr17:79455039-79455555]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79455081 rs558050110 T TG 5114248
chr17 79455130 rs6565573 A G 5114249
chr17 79455193 rs550414822 A G 5114250
chr17 79455225 rs529569295 C T 5114251
chr17 79455315 rs576193466 T TGG 5114252
chr17 79455342 rs8065136 G A 5114253
chr17 79455393 rs115590435 C T 5114254
chr17 79455402 rs68056047 CCCCGGGGCCTCCGGGATGTTCCGGGGCCGAGTTGTGCCTGTTGCCGTTTCCGGCG C 5114255
chr17 79455530 rs537074752 C A 5114256
Genes possibly regulated by ZZZ3[chr17:79455039-79455555]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr17:79455039-79455555]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results