EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:81036904-81041527]
Chromosome characteristics of ZNF143[chr17:81036904-81041527]
Back to top
Enhancers possibly regulated by ZNF143[chr17:81036904-81041527]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 81035965 81050038 enh17462
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Bone (Osteoblast) Stomach Placenta Muscle (Myotube) Blood (T-cell) Epithelial (MCF-7)
chr17 81038687 81040054 vista26503
VISTA
SNP sites on ZNF143[chr17:81036904-81041527]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 81036989 rs137987326 C T 5127449
chr17 81037126 rs190591846 G A 5127450
chr17 81037139 rs184077879 G T 5127451
chr17 81037199 rs188728273 C T 5127452
chr17 81037221 rs149483272 C T 5127453
chr17 81037323 rs193198309 C G 5127454
chr17 81037384 rs549572593 G GCGGGGCGGGGT 5127455
chr17 81037514 rs575539983 G A,T 5127456
chr17 81037644 rs554316782 T TC 5127457
chr17 81037715 rs184450074 C A 5127458
chr17 81037915 rs561240041 C G 5127459
chr17 81038141 rs9895110 G A 5127460
chr17 81038477 rs563834169 CTT C 5127461
chr17 81038570 rs201014210 C CG 5127462
chr17 81038733 rs533735221 GGCCCCC G 5127463
chr17 81038733 rs543385545 G GGCCCCC 5127464
chr17 81038733 rs557023726 G A 5127465
chr17 81038735 rs11651256 C T 5127466
chr17 81038748 rs536220963 C G 5127467
chr17 81039052 rs562547330 G A 5127468
chr17 81039059 rs543951733 T TG 5127469
chr17 81039062 rs529750153 G A,C,T 5127470
chr17 81039165 rs543392934 C G 5127471
chr17 81039234 rs79964142 A C 5127472
chr17 81039239 rs8068701 C A 5127473
chr17 81039258 rs550686880 G A 5127474
chr17 81039260 rs568978167 G A 5127475
chr17 81039277 rs536272749 C G,T 5127476
chr17 81039530 rs552311766 GAGGGGACCCCCCCACACACACACAC G 5127477
chr17 81039542 rs543201996 CCACA C 5127478
chr17 81039542 rs577939973 C CA 5127479
chr17 81039544 rs8069795 A C,G 5127480
chr17 81039561 rs145606529 A AC 5127481
chr17 81039686 rs148889058 TC T 5127482
chr17 81039726 rs144801512 C G 5127483
chr17 81039747 rs148136384 C T 5127484
chr17 81039932 rs146160498 G T 5127485
chr17 81040003 rs552867410 C T 5127486
chr17 81040155 rs535584428 G T 5127487
chr17 81040171 rs140157949 C T 5127488
chr17 81040193 rs58635421 C A 5127489
chr17 81040196 rs564430554 G C 5127490
chr17 81040285 rs529052437 C G 5127491
chr17 81040366 rs139329561 T C 5127492
chr17 81040534 rs140519611 C T 5127493
chr17 81040656 rs144380018 C T 5127494
chr17 81040721 rs189474843 A G 5127495
chr17 81040825 rs373344602 G A 5127496
chr17 81040847 rs7503602 T C 5127497
chr17 81040874 rs143467248 C T 5127498
chr17 81040907 rs11869715 G A 5127499
chr17 81040918 rs150925808 T G 5127500
chr17 81041001 rs569340112 G T 5127501
chr17 81041077 rs6502043 C T 5127502
chr17 81041106 rs181638826 C G,T 5127503
chr17 81041155 rs73360462 C G,T 5127504
chr17 81041180 rs185815124 C A,T 5127505
chr17 81041205 rs140795024 G A 5127506
chr17 81041338 rs6502044 A G 5127507
chr17 81041352 rs150118685 G A 5127508
chr17 81041381 rs138428540 G A 5127509
chr17 81041391 rs571660976 C CTTG 5127510
chr17 81041393 rs536671106 A T 5127511
chr17 81041489 rs543322798 TCGTGA T 5127512
chr17 81041490 rs139039360 C T 5127513
chr17 81041508 rs78392666 C G,T 5127514
Genes possibly regulated by ZNF143[chr17:81036904-81041527]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 81037567 81052864 + METRNL ENSG00000176845.8 81037567 0.77 1.0 663 16407
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr17:81036904-81041527]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results