EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr17:81039248-81039558]
Chromosome characteristics of ZNF217[chr17:81039248-81039558]
Back to top
Enhancers possibly regulated by ZNF217[chr17:81039248-81039558]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 81035965 81050038 enh17462
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Bone (Osteoblast) Stomach Placenta Muscle (Myotube) Blood (T-cell) Epithelial (MCF-7)
chr17 81038687 81040054 vista26503
VISTA
SNP sites on ZNF217[chr17:81039248-81039558]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 81039258 rs550686880 G A 5127474
chr17 81039260 rs568978167 G A 5127475
chr17 81039277 rs536272749 C G,T 5127476
chr17 81039530 rs552311766 GAGGGGACCCCCCCACACACACACAC G 5127477
chr17 81039542 rs543201996 CCACA C 5127478
chr17 81039542 rs577939973 C CA 5127479
chr17 81039544 rs8069795 A C,G 5127480
Genes possibly regulated by ZNF217[chr17:81039248-81039558]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr17:81039248-81039558]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results