Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 51756967 51769115 enh17717

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 51762290 rs35002074 AT A 5263277
chr18 51762290 rs398079481 AT A 5263278
chr18 51762408 rs147518156 GAATGTTTTCTCTCACTATCATCTCGATCACTTCCA G 5263279
chr18 51762408 rs533028249 G A,C 5263280
chr18 51762428 rs62096973 A T 5263281
chr18 51762438 rs62096975 C G 5263282
chr18 51762443 rs62096976 A G 5263283
chr18 51762473 rs603884 G C 5263284
chr18 51762485 rs531776142 C G 5263285
chr18 51762562 rs139510059 C T 5263286
chr18 51762634 rs73958746 T C 5263287
chr18 51762665 rs146629835 A G 5263288

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results