Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 41249652 41255415 enh16071

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 41251874 rs569352504 GCCTTAGGCCGCAGCATTAGGGAATTT G 3915427

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results