Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 42909807 42916775 enh60542

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 42910991 rs553955311 C G 3922817
chr15 42910995 rs576086194 A ATGTTGGCCAGCATGGTGTCGATC 3922818

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results