Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 44420269 44424419 enh68911

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 44423964 rs140980387 C CGGTGGTTGCCAGAGTGTGGTGGGAGAATAAAAT 3926661

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results