EnhancerDB
  1. Home
  2. TFBS
  3. LEF1[chr15:58082956-58082971]
Chromosome characteristics of LEF1[chr15:58082956-58082971]
Back to top
Enhancers possibly regulated by LEF1[chr15:58082956-58082971]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 58079405 58093075 enh52028
Brain (SK-N-MC) Large Intestine Muscle (A673) Peripheral Blood (MM.1S) Uterus Epithelial (MCF-7)
SNP sites on LEF1[chr15:58082956-58082971]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 58082965 rs570155594 G A 3982007
chr15 58082968 rs572463113 C CAACAAACTTACCATAGCTTACCA 3982008
chr15 58082969 rs570501631 T TAC 3982009
chr15 58082970 rs539447294 C CATA 3982010
Genes possibly regulated by LEF1[chr15:58082956-58082971]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by LEF1[chr15:58082956-58082971]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results