Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 58557045 58564595 enh16170

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 58562564 rs75282436 G GGTGTGGCTGTACCCAGAAGGT 3984695

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results