EnhancerDB
  1. Home
  2. TFBS
  3. HSF1[chr15:59565808-59565823]
Chromosome characteristics of HSF1[chr15:59565808-59565823]
Back to top
Enhancers possibly regulated by HSF1[chr15:59565808-59565823]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 59556385 59580733 enh16189
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Stomach Placenta Colon (HCT116) Lung (PC-9) Breast Pancreas (Panc1) Epithelial (MCF-7)
SNP sites on HSF1[chr15:59565808-59565823]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 59565817 rs553545392 CCGGAGGAGACCAGAGGAGGAAGGACATTCATTATAATCTA C 3991889
chr15 59565818 rs186549021 C T 3991890
Genes possibly regulated by HSF1[chr15:59565808-59565823]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HSF1[chr15:59565808-59565823]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results