EnhancerDB
  1. Home
  2. TFBS
  3. MEF2C[chr15:60671641-60671656]
Chromosome characteristics of MEF2C[chr15:60671641-60671656]
Back to top
Enhancers possibly regulated by MEF2C[chr15:60671641-60671656]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 60669725 60674461 enh16205
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Stomach Muscle (A673) Placenta Lung (PC-9) Pancreas (Panc1) Epithelial (MCF-7)
SNP sites on MEF2C[chr15:60671641-60671656]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 60671656 rs369705319 TCAAGGCAATGAAAAAAATC T 3999410
chr15 60671656 rs377135916 TCAAGGCAATGAAAAAAATC T 3999411
Genes possibly regulated by MEF2C[chr15:60671641-60671656]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MEF2C[chr15:60671641-60671656]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results